Ryanair's globalisation process Essay Example | Topics and Well Written Essays - 2000 words

Ryanair's globalisation process - Essay Example However, new markets come with more challenges in some cases leading to losses to the firm (GOLDMAN & NIEUWENHUIZEN 2006, p.9). Therefore, proper evaluation of the market has to be undertaken to ensure higher chances of success in the new market. Opening up of markets also means a new challenge to the existing market leaders as they are faced with new competition thus the need to change strategy. Changes in regulation also affect the operation of firms in the market thus the need to regularly check regulations to ensure compliance (LOWENDAHL 2005, p.163). At times, the firm may be forced to get back to the drawing board to formulate new way forward so as to be profitable in the global market. Any business desiring to compete in the global market has to make the bold decision of taking on a risky investment (SHETH, PARVATIYAR & SHAINESH, 2001, p.34). In the process of globalization, signing of agreement between Ire and London to open up air traffic between them was the beginning of globalization process in the two countries presenting Ryanair an opportunity to explore new market. In anticipation of increased air traffic between Irish and London, Ryanair made the bold decision of applying for the newly available license to be given to a second firm after the signing of the new air service agreement. Without any past records on the success of the rout in air traffic, applying for the license to operate the route was risky as returns were not assured. Other firms not applying for the license is an indication that there was general fear of investing in new markets. The opportunity came with additional cost requiring additional resources. This is the cost of globalization that the firm had to incur so as to earn revenue from the new investment. The firm incurred cost of purchasing two more planes to satisfy the increasing operations. Increased competition in the market place is also forcing big firms to change their operations to maintain their market

Tinker v. Des Moines (1969) or Texas v. Johnson (1989) Research Paper

Tinker v. Des Moines (1969) or Texas v. Johnson (1989) - Research Paper Example Selma, Alabama was the center of the Civil Rights Movement. Martin Luther King Jr. and 700 others were arrested during demonstrations against state regulations on voting. On the social front, miniskirts first made their appearance and health warnings were placed on packs of cigarettes. President Johnson signed into effect the Voting Rights Act, which ensured equality for all at the voting booth, by eliminating literacy tests and other barriers. He also signed the Elementary and Secondary Education Act, which initiated Title 1, which ensured remedial education for students in need, and the Head Start Program which began in May. In December of 1965, John and Mary Beth Tinker, and Christopher Eckhardt were members of a community group against the American involvement in the Vietnam War. John, fifteen years old, and Christopher, sixteen years old, were high school students in Des Moines, Iowa. Mary Beth, John’s sister was a thirteen year old junior high student. To demonstrate their objections and to promote their support for a holiday truce, they decided to wear black armbands from December 16 to New Year’s Day (Cornell University Law School). The school authorities in Des Moines discovered in advance the plan of the students to wear the armbands, and issued a policy on December 14 stating that any student wearing armbands would be sent home and suspended until they could return to school without them. Their fear was that the armbands would create a disturbance to the school environment, especially considering that a school graduate had been killed in the Vietnam War. Two days following the issuance of the new school policy, the above-mentioned students wore the black arm bands. The students were aware in advance of the new policy. After school officials requested that they remove the armbands, they refused. The students were then sent home suspended from school, and returned

Different Aspects of Pain Essay Example for Free

Different Aspects of Pain Essay Pain is a subject to which all people can relate. There are many different types of pain, and people react to these pains in various ways. Pain is also caused from many different sources. It could be from grief, stress, or a significant event that occurs in one’s life. Pain is defined in the Dictionary as â€Å"mental or emotional suffering or torment.† The poetry of Robert Frost, James Langston Hughes, and Emily Dickinson all display different aspects of pain. Robert Lee Frost was born on March 26, 1874 in San Francisco, California where his father worked as a newspaper editor. This may have been where Robert was first exposed to the aspect of writing. Robert’s first published poem was in a school newspaper at the age of 16 where he wrote a poem on the subject of Cortez in Mexico. Although he attended Dartmouth for seven weeks and spent two years at Harvard, he never finished a college education with a degree. After he had gotten married, he worked as a schoolteacher, and during this period is when he spent time writing the majority of his poetry. After his teaching career, he moved to England to pursue getting his works published since his poetry was not accepted for publishing in America. His first two books of poems, A Boy’s Will and North of Boston, were published in England and then later in America due to the overwhelming popularity of them in England (Greenberg ix-x). Frost’s poem â€Å"Out, Out† tells a story of the tragic death of a boy due to a buzz saw. The title is an allusion to act five William Shakespeare’s Macbeth, where the main character, Macbeth, performs a soliloquy regarding the death of his wife: Out, out, brief candle! / Lifes but a walking shadow, a poor player / That struts and frets his hour upon the stage / And then is heard no more. It is a tale / Told by an idiot, full of sound and fury, / Signifying nothing. The allusion to Shakespeare in the title is appropriate to the subject matter because the soliloquy of Macbeth states that life is short, and inevitably will end. That is the message that Robert Frost is trying to convey in this poem. There are two different aspects of pain that appear in â€Å"Out, Out.† The first  one is the aspect of physical pain. This occurs when the buzz saw the boy is using, hits the boy’s hand and injures the hand severely. â€Å"As if to prove saws knew what supper meant, / Leaped out at the boy’s hand, / or seemed to leap (Frost 522)† The boy then begins to feel the pain of what has just happened, the physical pain of his hand being severed by the buzz saw. The next type of pain that can be seen here is the psychological pain, caused by stress. As a result of the boy’s injury, he begins to fall into pieces about the whole matter (clarify this somehow. â€Å"fall into pieces† sounds a little ambiguous as well as clichà ©) . The poem says that the boy â€Å"half in appeal, but as if to keep / the life from spilling. Then the boy saw all (Frost 522).† These two lines of the poem depict that the boy is old enough to understand what is going on with what is happening. His hand is injured beyond what the doctors can repair, and there is a high possibility of death because of what has just happened. The word ‘Life’ in this poem represents the blood that flowing from his hand. One can also see the apathy displayed by the rest of his family. Even though a member of the family has just died due to a tragic accident â€Å"Littlelessnothing!and that ended it (Frost 522)† they show no pain of the loss of a family member. It is depicted in the last two lines of the poem, â€Å"No more to build on there. And they, since they / Were not the one dead, turned to their affairs (Frost 522).† This shows that they had no emotion to the event, and went on to what they were doing as if nothing had happened in the first place. The second piece of poetry presented is one by James Langston Hughes. James Langston Hughes was born February 1, 1902 in Joplin Missouri. He spent his early life living with his grandmother in Illinois. Hughes began to write poems, and also some short stories, while he was in high school. Hughes mentions that the primary influences to his writing are Paul Lawrence Dunbar, Carl Sandburg, and Walt Whitman. His first book of poetry, entitled The Weary Blues, was published in 1926, while he was in college. Hughes graduated from Lincoln University three years following the publication of his first book of poetry. The year following his college graduated, Hughes  won the Harmon gold medal for literature for the first novel that he wrote, Not Without Laughter. James Langston Hughes poem â€Å"The Negro Speaks of Rivers† was the first poem of his that was published. This poem was also set to music later on. It is written from the perspective of a man that ties together African and African-American history. Hughes does this by naming different rivers that are in Africa and also those that are in the United States. This is where the wordplay of Langston Hughes can be seen. The type of pain that is displayed in this poem is not very obvious, but it is more implied than directly stated. Seeing that this poems speaks of African and African-American History, the idea of the oppression that these people groups have gone through is something that can be inferred from what the poem says. Both of these people groups have gone through major oppression because of slavery, inequality, and the like. (while it is not obvious I would recommend trying to find a few lines that can possibly show the pain) The final poem presented here is a poem from Emily Dickinson. Emily Dickinson was born in the year 1830 in a family that was considered to be very wealthy for that time period. Her father ultimately led the family and was a religious man for the family. He read prayers and passages of scripture to all that lived in the household to maintain this. She attended the seminary for a year, but went home after that year due to a significant amount of unpleasant experiences. After Emily left school, she isolated herself from all activities and responsibilities that were outside of the household, and kept to herself most of the time. She spent a significant amount of time reading books. Because of the morals that her father had, there were not many things for her to choose from, as her father thought that most books that were available at the time might shake up her thinking patterns. She then settled to read the Bible, classical myths, and also the works of William Shakespeare. Because of this, a great amount of the poems that she wrote had allusion to her readings contained in them. Although there is very little that people know of Emily Dickinsons outside life, but after reading the  poems that she has written, one can gain some access to the inside life in Emily Dickinson (Madden 1287). Emily Dickinson wrote nearly two thousand different poems in her lifetime (Madden 1288). Only but a few of these poems were intentionally published by her. Although Emily made her brother and sister promise to destroy all of her works following her death, her sister, Lavinia, could not gain the strength to destroy her sister Emily’s poetry. Not too far following her death in 1886, nine volumes of her works that were revised in wording, punctuation, structure, and rhyme were published. Unedited versions that were true to the original manuscript of Emily Dickinson where not published until 1955 (Madden 1288). Most of the poems of Emily Dickinson were her own personal laments that she did not intend for the public to ever see. â€Å"After A Great Pain, A Formal Feeling Comes† is an example of one of these extremely personal poems. During the time that this poem was written, Dickinson had just lost a very close friend. She was also beginning to dismiss the ideas of a career, starting a family, and making contact with anything or anyone that was outside of her own house. This whole poem directly deals with the pain of emotional loss that comes with the passing away of a person that is extremely close. Death was something that Dickinson never adjusted to, and it is displayed in this poem. She depicts how the feeling sits heavily and does not seem to go away very quickly â€Å"The Nerves sit ceremonious, like Tombs(Dickinson 1291)† (Lundin 95). In the last two lines of the first stanza Dickinson says, â€Å"The stiff Heart questions what it He, that bore, / And Yesterday, or Centuries before? (Dickinson 1291)† Here she is reliving past pains and grief that have occurred in her life before the death of her friend. She also relives past painful moments in her life in the second stanza â€Å"The Feet, mechanical, go round (Dickinson 1291)† (Grabher 217). In the last stanza, Dickinson focuses on the present pain that is in her life. â€Å"This is the Hour of Lead (Dickinson 1291)† refers to the passing of  Dickinson’s close friend. She then goes over the stages of how she moves on from these painful experiences: â€Å"As Freezing persons, recollect the Snow / FirstChillthen Stuporthen the letting go (Dickinson 1291)† The way that she ends this poems makes it appear as though she is trailing off into a land of thought to go dwell on what has just happened, to begin her process of recovery (Lundin 234). As one can see, many different aspects of pain have been discussed. Robert Frost’s â€Å"Out, Out† discussed physical pain due to an injury, and also the pain of stress due to that injury. James Langston Hughes implied the racial oppression of Africans and African-Americans that had gone before him in â€Å"The Negro Speaks of Rivers.† Emily Dickinson goes deep into her personal life and displays emotional pain with â€Å"After A Great Pain, A Formal Feeling Comes† by reminiscing on past grief and dealing with a new grief due to the death of a friend. As one reads through and analyzes these poems, one can see the way that pain is displayed in the midst of them and how each separate type affects people in different ways.

UCA1 in Cisplatin Induced Ovarian Cancer Cell Resistance

UCA1 in Cisplatin Induced Ovarian Cancer Cell Resistance The Expression of Long Non-coding RNA UCA1 in Human Ovarian Cancer Cells and Its Role in Cisplatin Cytotoxicity in Vitro Running title: UCA1 in cisplatin induced ovarian cancer cell resistance Highlights Increasing expression of UCA1 RNA was found in ovarian cancer tissues. UCA1 can increase the cell migration, invasion and cisplatin resistance. The effect of UCA was extended through targeting SRPK1 and apoptosis related pathway. Abstract Objective: The therapeutic potential of cisplatin in ovarian cancer treatment is limited by the occurrence of cellular resistance. To explore the role of long non-coding RNA UCA1 in cisplatin induced ovarian cancer cell resistance. Methods: Twenty-four ovarian cancer tissues and sixteen normal tissues were used to assess the expression of UCA1 RNA. After expression UCA1 in SKOV3 cells, the cell migration, invasion and cisplatin resistance was assessed. Furthermore, the related mechanism was also explored. In addition, SRPK1 knockdown cell line was established and the effect of SRPK1 on cell migration, invasion and cisplatin resistance was also evaluated. Results: The increased expression of UCA1 RNA was identified in 24 ovarian cancer tissue compared with normal tissue. Expression of UCA1 RNA in SKOV3 cells increased the cell migration, invasion and cisplatin resistance. Alternated expression of SRPK1 and apoptosis related proteins were found in SKOV3/pcDNA-UCA1 cells. The effect of UCA1 expression on cell migration, invasion and cisplatin resistance was reversed by knocking-down SRPK1 in SKOV3 cells. Conclusions: Increasing expression of UCA1 RNA was found in ovarian cancer tissues. UCA1 can increase the cell migration, invasion and cisplatin resistance. The effect of UCA was extended through targeting SRPK1 and apoptosis related pathway. Key words: Long non-coding RNA, UCA1, SRPK1, cisplatin resistance, cell migration, invasion Introduction Ovarian cancer is the second most commonly diagnosed gynecological cancer in the world, and causes more deaths per year than any other the female reproductive system related cancer(1). More than 200,000 cases are newly diagnosed and 120,000 women die of ovarian cancer annually all over the world(2). Platinum based chemotherapy is active in ovarian cancer treatment. However, intrinsic or acquired cellular resistance to cisplatin is encountered regularly and severely limits the therapeutic potential of the drug(3). Multiple biological processes, such as dose accumulation, metabolism, apoptosis, DNA damage, are involved in the mechanisms of cellular resistance(4). Conquering cisplatin resistance remains therefore a critical goal for anticancer therapy and considerable efforts have been undertaken to solve this problem throughout the past three decades. Previous studies have shown that serine/arginine-rich protein-specific kinase 1(SRPK1) and apoptosis related protein are closely related with cisplatin resistance. SRPK1 is a kinase which belongs to SR kinase family (5). Through regulating the phosphorylation of SR splicing factors, SRPK1 can afftect the pre-mRNA splicing and consequently gene expression (6). Increasing attentions have been paid on the role of SRPK1 in cisplatin resistance(7-8). The apoptosis resistance induced by anticancer drug treatment has been suggested as another important mechanism in cellular resistance(4). More and more studies have shown that abnormal expression of long non-coding RNA (lncRNA) is involved in tumor development and progression(9). In a previous study, we obtained lncRNA UCA1 using RACE and found that higher expression of lncRNA UCA1 in bladder tumor tissues than normal tissues(10). Here, we tried to assess the expression of UCA1 and SRPK1 in ovarian cancer tissue and normal tissue using RT-PCR and explore the role of UCA1 in cisplatin induced ovarian cancer cell resistance. Our results might provide theoretical basis for chemotherapy selection in clinic and a novel cisplatin resistance related target was also suggested. Methods and materials Cell culture, Patients and Ovarian tumor specimens The human ovarian cancer cell line SKOV3 was maintained at 37 °C and 5% CO2 incubator in RPMI-1640 media with 10% fetal bovine serum, 100 U/ml penicillin, and 100  µg/ml streptomycin. Flash frozen tissue specimens (n= 40) were obtained from patients undergoing debulking surgery for ovarian cancer at People’s hospital of Shaanxi Providence, Shaanxi, China from January 2010 to January 2013. Among the specimens, epithelial ovarian cancer (n=24) were obtained from primary lesion of the patients without radiochemotherapy while normal ovarian samples (n= 16) were obtained from patients undergoing hysterectomies for benign conditions. The pathological examination on all tissues was confirmed by two experienced physician. Written consent was provided by each patient and the whole protocol was proved by the Review Board of the hospital. Reverse transcription PCR analysis Total RNA extraction of cancer tissue or cells were performed with Trizol (Life Tech, US) and the reverse transcription reaction were performed with ImProm II reverse transcriptase(Promega, US) according to the manufacturer’s instruction. UCA1, SRPK1, 18S rRNA specific sequences were amplified during 30 cycles of 30 s denaturing at 95 °C, 60 s annealing at 57 °C, and 60 s extension at 72 °C, with the primers listed in Table 1. Table 1 Primer sequences used in the study Name Forward primer Reverse primer UCA1 CTCTCCATTGGGTTCACCATTC GCGGCAGGTCTTAAGAGATGAG SRPK1 TAACGGACCACTGGACAACAAA TTCCTGCGACCACTCATACTTC 18S rRNA CAGCCACCCGAGATTGAGCA TAGTAGCGACGGGCGGTGTG UCA1 (full length) CGGGATCCTGACATTCTTCTGGACAATGAG CCGGAATTCGCATATTAGCTTTAATGTAGGTGGC Expression of UCA1 in SKOV3 cells The full length of UCA1 was expanded by PCR (The primer was showed in Table 1) at an annealing temperature of 53  °C. After digested with BamHI and EcoRI, the PCR fragment was subcloned into pcDNA3.1 to construct the pcDNA-UCA plasmid. Transient transfection of cells with plasmid was performed with Lipofectamine ® 2000 (Life Tech, US). Twenty-four hours later, G418 selection(500  µg/mL) was processed for 3 weeks. The characterization of the positive clone was confimed by RT-PCR. The pcDNA3.1 without UCA1 fragment was used as negative control. RNAi The shRNA sequences of SRPK1 were obtained according to previous description(11). SH1 and SH3, encoding shRNA targeting nucleotides 1423 to 1443 (GGTCAGTCATTCAGTGAACAA) and 288 to 308 (CAAGAAGATCCTAATGATTA), respectively, of the SRPK1 mRNA, were processed with annealing, subcloning into PRNAT-U6.1/Neo plasmid (GenScrpt Corp., Piscataway, NJ, US), plasmid expansion and media amount extraction. Transient transfection of cells with plasmid was performed with Lipofectamine ® 2000 (Life Tech, US) and 3 different batch of cells were used for knockdown efficacy examination. Stable cell lines were obtained by G418 selection for 3 weeks. The expression of SRPK1 was confirmed by western-blot analysis. Western-blot analysis The frozen myocardial tissues were lysed in RIPA buffer (Beyotime, China), followed by high speed centrifugation and BCA quantification. Cellular protein was separated by electrophoresis on SDS-PAGE gel and then transferred onto PVDF membrane. After blocking, the blots were incubated with the antibodies to SRPK1 (BD), Bcl-2 (Cell Signaling Technology), BAX (Cell Signaling Technology), caspase-3(Cell Signaling Technology), aspase-3(Cell Signaling Technology). And ÃŽ ²-Actin(Cell Signaling Technology) was used as loading control. The appropriate HPR conjugated secondary antibodies were applied. The protein bands detected with SuperSignal Ultra Chemiluminescent Substrate (Pierce) on X-ray films (Koda). MTT After preparing the single cell suspension, 4Ãâ€"103 cells in 100 ÃŽ ¼L culture media were seeded in 96-well plate in quadruplicate overnight. MTT was added for 4 hr, and formazan dye was dissolved with DMSO and read at 490 nm in a microplate reader (Molecular Device, US). All the experiments were performed for three times. Clonogenic Survival Assay Cells (5Ãâ€"102) were seeded in 6-well plates overnight and incubated with RPMI1640 + 10%FBS + 500 ÃŽ ¼g/ml G418 for 14 day. After removing the media, cells were washed with PBS, fixed with 95% ethanol for 30 min and stained with Giemsa for 15 min. Colonies with >50 cells were counted under microscope. Percentage cell survival is expressed relative to untreated control. Scratch assay 3.0Ãâ€"105 cells were seeded in 6-well plates and the cells were allowed to grow until 90% confluence was reached. Then the cells were grown in 0.2% FBS RPMI1640 media overnight for resting and a scratch was made by using the 200 ÃŽ ¼L pipette tip. The photos were taken at 0 h and 24 h under a microscopy and the relative migrating distances of the wound areas were measured on the images. 3-D migration and Invasion assay Cells (5Ãâ€"105) were seeded in triplicate in upper chamber of the Millicell (8 ÃŽ ¼m pore diameter) which was pre-coated with Matrigel (Becton Dickinson Labware, Bedford, MA). After the lower chamber of the Millicell was added with 900 ÃŽ ¼L RPMI 1640 +20% FBS, the Millicell was incubated at 37 °C and 5% CO2 for 24 hrs. Then the Matrigel was removed by cotton tip, fixed with 95% ethanol for 30 min, stained with Giemsa staining. The membrane was checked with microscopy. The migration assay was similar with invasion assay but with 12 hr incubation time. Cisplatin resistance assay Cells (3Ãâ€"104) were seeded in quadruplicate in 24-well plate and allowed to adhere overnight. Then the cells were treated with serious concentration of cisplatin(0,2.5,5,10, 20,40,80 ÃŽ ¼M) for 48 hr. Cell viability was determined by MTT assay at 490 nm wavelength. Statistical analysis All statistical analyses were performed using the SPSS13.0 software. The results were presented as means  ± SD. Two-tailed Student’s t-test was used to examine the differences between groups. P Results The expression of UCA 1 RNA and SRPK1 mRNA in ovarian tissues Twenty-four ovarian epithelial cancer tissue and sixteen normal ovarian tissue was used to assess the UCA1 and SRPK1 expression. And we found higher expression of UCA 1 RNA and SRPK1 mRNA in ovarian cancer tissue while no significant expression of UCA1 and SRPK1 was found in normal ovarian tissue(Figure 1A). The effect of UCA1 RNA expression on SKVO3 migration and invasion Cell lines establishing After constructing of pcDNA-UCA1, the stable cell lines with or without UCA1 RNA expression were established. The positive control was confirmed by RT-PCR and the result showed that a length of 1442 bp UCA1 RNA was expanded from SKOV3/pcDNA-UCA1 while no UCA1 was found in negative control SKOV3/pcDNA 3.1(Figure 1B). 2-D and 3-D Migration and invasion assay The scratch assay suggested that cell migration ability of SKOV3/pcDNA-UCA1 was significantly increased that of SKOV3/pcDNA 3.1(Figure 1C). The 3-D migration and invasion assay with millicell chamber showed that the migration and invasion abilities were significantly increased in SKOV3/pcDNA-UCA1 cell than SKOV3/pcDNA 3.1 cells(Figure 2A). Cisplatin resistance assay The cisplatin resistance assay was performed with SKOV3/pcDNA-UCA1 and SKOV3/pcDNA 3.1 cells by MTT. Increased cisplatin resistance was found in SKOV3/pcDNA-UCA1 cell. The IC50 of SKOV3/pcDNA-UCA1 cells increased 2.41 times than that of SKOV3/pcDNA 3.1 cells(Figure 2B). Western blot analysis of SRPK1 and apoptosis pathway To explore the mechanism we analyzed the expression of SRPK1, Bcl-2, Bax, Caspase3 and Caspase9 in SKOV3/pcDNA-UCA1 and SKOV3/pcDNA 3.1 cells and found that increased expression of SRPK1 and Bcl-2 and decreased expression of Bax, Caspase3 and Caspase9 in SKOV3/pcDNA-UCA1 cells (Figure 2C). The effect of SRPK1 knockdown on SKOV3 cells Knockdown cell line establishing The knockdown efficacy of pRNAT-SH1 and pRNAT-SH3 were firstly examined by transient transfestion and western-blot. And the results showed that SKOV3/ pRNAT-SH3 was extend a better effect of knocking down SRPK1 (Figure 3A1). Stable cell lines of SKOV3/pRNAT-SH3 and SKOV3/pRNAT-U6.1 were also established and the effect of pRNAT-SH3 on SRPK1 knockdown was showed in Figure 3A2. The proliferation, colongenic, migration, invasion abilities of SRPK1 knockdown The result of MTT assay was showed that decreased proliferation was found in SKOV3/pRNAT-SH3(Figure 3B). The colongenic ability of SKOV3/pRNAT-SH3 was significantly decreased than that of SKOV3/pRNAT-U6.1(Figure 3C). The 3-D migration and cell invasion assay showed that the cell migration and invasion were decreased in SKOV3/pRNAT-SH3 cells than SKOV3/pRNAT-U6.1 cells(Figure 4A). Cisplatin resistance assay The cisplatin resistance assay was performed with SKOV3/pRNAT-SH3 and SKOV3/pRNAT-U6.1 cells by MTT. Increased cisplatin resistance was found in SKOV3/pRNAT-SH3 cell. The IC50 of SKOV3/pRNAT-SH3 cells was increased 2.64 times than that of SKOV3/pRNAT-U6.1 cells(Figure 4B). Western blot analysis of SRPK1 and apoptosis pathway To explore the mechanism we analyzed the expression of SRPK1, Bcl-2, Bax, Caspase3 and Caspase9 in SKOV3/pRNAT-SH3 and SKOV3/pRNAT-U6.1 cells and found that increased expression of SRPK1 and Bcl-2 and decreased expression of Bax, Caspase3 and Caspase9 in SKOV3/pRNAT-SH3 cells (Figure 4C). Discussion The lnc RNA UCA1 was cloned in our lab using SMAT-RACE from the bladder cancer cell line BLZ-211. And UCA1 RNA showed an expression pattern of increasing expression in early stage of human embryonic development, differential expression at 28 week of embryonic development, no expression in normal adult tissues. However, the expression of UCA1 RNA was increased in bladder cancer tissues(10). In addition, the increasing expression of UCA1 RNA than the normal or para-carcinoma tissueswas also found in breast cancer, liver cancer, thyroid cancer, cervical cancer, lung cancer, esophagus cancer, gastric cancer and so on(12). We didn’t observe an obvious expression of UCA1 RNA in normal tissues and did observe the expression of UCA1 RNA in ovarian cancer tissues. This suggested UCA1 RNA may extent a critical role in the development and progression of ovarian cancer. The previous study showed that the abilities of cell proliferation, cisplatin resistance, invasion and migration were increased in bladder cancer cell line(13). Yang et al showed that UCA1 can regulate the cell cycle through CREB and PI3K pathway(14). Wang et al found that overexpression of UCA1a(also named as CUDR) in bladder cancer cells would increase the abilities of cell proliferation, invasion and cisplatin resistance and decrease cell apoptosis(15). Wing et al showed that increased expression of UCA1a could increase the cellular resistance and decrease the apoptosis in A431 squamous cancer cells. However, the mechanism is still unknown(16). The cisplatin resistance of ovarian cancer is the main cause of tumor recurrence and the failure of chemotherapy. The mechanisms of cisplatin resistance included dose accumulation of the drug, metabolism, apoptosis and DNA damage and it is a complicate process of multi-factor, multi-level and multi-gene. SKOV3 was used to assess the cisplatin resistance effect in ovarian cancer. We established SKOV3 cell lines expressing UCA1 RNA and found that cell abilities of migration, invasion and cisplatin resistance were increased, which was consistent with the results obtained from the bladder cancer cell lines. Since SRPK1 was proved to involve in the cisplatin resistance(17-18), we also tried to analyze the association between UCA1 RNA and SRPK1. And the western blot results showed that increased expression of SRPK1 and Bcl-2 while decreased expression of Bax, Caspase 3 and Caspase 9. SRPK1 is specific kinase belonged to SR family. It can specifically phosphorylate the SR splice factor and regulate the gene expression by alternative splicing of pre-mRNA of target gene(6). Hayes et al found decreased expression of SRPK1 in pancreas, colon and breast cancer could lead to increasing and decreasing expression of Bcl-2 and Bax. The decreasing on cell proliferation and increasing on cell apoptosis were found (19). Furthermore, increased sensitivities of Gemcitabine and Cisplatin were also found (11, 19). In order to confirm whether SRPK1 is involved in the mechanism of UCA1 regulating ovarian cancer proliferation and migration, we employed RNAi to decrease the expression of SRPK1 and found that increased expression of Bcl-2 and decreased expression of Bax, Caspase 3 and Caspase 9 after downregulating the expression of SRPK1. In addition, we found the increasing abilities on cell proliferation, migration and invasion after SRPK1 knockdown. In conclusion, we found UCA1 RNA may increasing of cell proliferation, decreasing apoptosis and lead to the cisplatin resistance by increasing the expression of SRPK1 and affecting the expression of apoptosis related proteins(such as Bcl-2, Bax, Caspase 3 and Caspase 9). Our results will add novel insight on cisplatin resistance and provide novel molecular target to the treatment.

The Silent Partner: A Canadianization Dilemma :: Film Movie Movies Canada Silent Partner Essays

The Silent Partner: A Canadianization Dilemma Works Cited Missing As a student of Canadian film, I find great appreciation in films that work to culturally enrich Canada's movie screens. I feel that an honest portrayal of Canadian values and culture is beneficial not only by enhancing the credibility of Canada's film industry, but also by maintaining a voice for the customs held by the Canadian people. For these reasons, among others, it had become very easy for me to dislike Daryl Duke's 1978 film The Silent Partner. Based on the knowledge I had before sitting through numerous screenings of the film, I found a challenge in making any concretely positive statements about it, or the state of Canada's film industry at the time. I asked myself about the effect this film had on Canada's film industry, wondering primarily if the film's success in Canada - it won a total of 6 Canadian Film Awards including best feature and best director - came not from a poignant portrayal of Canadian culture, but rather from a "Canadianization" of the typical American t hriller. I questioned the details of the film's formation, the choices made about talent, and the credibility of the script, and still I found myself forcing out any positive criticisms I might muster. As far as first impressions go, The Silent Partner's was not promising. Perhaps now I must consider an alternate approach to understanding this film. Maybe my difficulty in pinpointing The Silent Partner's positive attributes demonstrates to some extent my current narrow-mindedness on Hollywood-style pictures. I think it's only fair to treat this film as an article of film criticism in order to accurately look at it within the context of a national cinema. And so, let us begin by looking first at the particulars of the Canadian film industry around the time The Silent Partner was released. Maybe afterwards, we'll be able to understand the implications of what audiences saw on that illustrious Canadian screen I feel so emotionally bound to preserving. The code word for success in the late seventies was "international appeal." In a time referred to as "the tax-shelter boom," it was perceived by some that the Canadian film industry had given in. Demoralized by countless relatively unsuccessful attempts at profitability and independence, "Canada's feature film industry had finally succumbed to that old adage: If you can't beat 'em, join 'em" (Magder 169). The Silent Partner: A Canadianization Dilemma :: Film Movie Movies Canada Silent Partner Essays The Silent Partner: A Canadianization Dilemma Works Cited Missing As a student of Canadian film, I find great appreciation in films that work to culturally enrich Canada's movie screens. I feel that an honest portrayal of Canadian values and culture is beneficial not only by enhancing the credibility of Canada's film industry, but also by maintaining a voice for the customs held by the Canadian people. For these reasons, among others, it had become very easy for me to dislike Daryl Duke's 1978 film The Silent Partner. Based on the knowledge I had before sitting through numerous screenings of the film, I found a challenge in making any concretely positive statements about it, or the state of Canada's film industry at the time. I asked myself about the effect this film had on Canada's film industry, wondering primarily if the film's success in Canada - it won a total of 6 Canadian Film Awards including best feature and best director - came not from a poignant portrayal of Canadian culture, but rather from a "Canadianization" of the typical American t hriller. I questioned the details of the film's formation, the choices made about talent, and the credibility of the script, and still I found myself forcing out any positive criticisms I might muster. As far as first impressions go, The Silent Partner's was not promising. Perhaps now I must consider an alternate approach to understanding this film. Maybe my difficulty in pinpointing The Silent Partner's positive attributes demonstrates to some extent my current narrow-mindedness on Hollywood-style pictures. I think it's only fair to treat this film as an article of film criticism in order to accurately look at it within the context of a national cinema. And so, let us begin by looking first at the particulars of the Canadian film industry around the time The Silent Partner was released. Maybe afterwards, we'll be able to understand the implications of what audiences saw on that illustrious Canadian screen I feel so emotionally bound to preserving. The code word for success in the late seventies was "international appeal." In a time referred to as "the tax-shelter boom," it was perceived by some that the Canadian film industry had given in. Demoralized by countless relatively unsuccessful attempts at profitability and independence, "Canada's feature film industry had finally succumbed to that old adage: If you can't beat 'em, join 'em" (Magder 169).

Japan Caught Between US and China :: essays research papers

Japan caught up in U.S.-China spat Japan came under criticism in the fallout of a heated exchange between the United States and China over Taiwan at the Asia Security Conference here. In fact, some participants said Japan-not China-is the country creating the most fears in Asia. The three-day conference, hosted by the London-based International Institute for Strategic Studies, ended Sunday. A key topic of debate was a Japan-U.S. agreement reached in February on common strategic objectives-including how to deal with Taiwan. The joint statement said the objective was to "encourage the peaceful resolution of issues concerning the Taiwan Strait through dialogue." In his speech in Singapore on Saturday, U.S. Defense Secretary Donald Rumsfeld questioned the validity of China's increased military spending when the country faced no threats, as well as its heightened deployment of ballistic missiles aimed at Taiwan. Cui Tiankai, director-general of the Asian Affairs Department at China's Foreign Ministry, retorted by asking Rumsfeld if the United States felt threatened by the stronger presence of China. Rumsfeld had to diplomatically admit there was no such threat. However, in a subsequent question-and-answer session, both Rumsfeld and Defense Agency chief Yoshinori Ono were asked about the common strategic objective pertaining to Taiwan. Ralph Cossa, president of the Pacific Forum, which is affiliated with the Washington-based Center for Strategic and International Studies, asked Rumsfeld for his interpretation of reports in many Asian nations that the common strategic objective meant Japan and the United States would act together to defend Taiwan. Rumsfeld only said that the contents of the joint statement were in the public domain. Cossa then asked Ono about the growing perception in Asia that Japan and the United States would contain China as a means of defending Taiwan. Ono simply responded that the joint statement should be read carefully. In response to questions from The Asahi Shimbun, one of the sponsors of the conference, Cossa said many nations in East Asia were concerned about Japan's defense policy. "With the issue of Prime Minister Junichiro Koizumi's visits to Yasukuni Shrine also coming into the picture, the view is emerging among Asian countries that the nation truly to be afraid of is not China, but Japan," said a Singapore-based researcher. The latest Asia Security Conference saw the first participation of a delegation of Chinese government officials.

Isaac Asimov: Envisioning the Future of Our Own Humanity

â€Å"If it brings me humanity, that will be worth it. If it doesn't, it will bring an end to striving and that will be worth it, too. † (The Bicentennial Man 22). Isaac Asimov, a dreamer who with humble beginnings pushed science fiction into the beginnings of reality. There is no one quite like Asimov. He has written more on more subjects, and better on more subjects, and more unexpectedly on most subjects, and in more ways on more subjects, than anyone else in the field. He writes poetry, limericks, short stories, novels, essays, articles, nonfiction books, trilogies, jokes and so on-more of them than anyone else could imagine (The Bicentennial Man 1). With all his intelligence, and all his heart, he fought for a world in which his ideas could become reality. His humanity was found in his struggle to educate us all, encouraging us to expand our horizons beyond our own lack of knowledge. This fact is alluded to in an article he wrote to Newsweek in the 1980s, â€Å"There is a cult of ignorance in the United States, and there always has been. The strain of anti-intellectualism has been a constant thread winding its way through our political and cultural life, nurtured by the false notion that democracy means that ‘my ignorance is just as good as your knowledge’† (â€Å"A Cult of Ignorance† 19). His view of the world included us understanding. His oppression was caused by our ignorance. Isaac Asimov was born sometime between October 4, 1919 and January 2, 1920 (In Memory Yet Green 1). His parents did not remember the exact date of his birth but claim it to be around that time. He himself celebrated it on January 2nd (In Memory Yet Green 1). He was born to Anna Rachel Berman Asimov and Judah Asimov, a Jewish Russian couple. At the age of three, his whole family immigrated to the United States to the city of Brooklyn, New York (Biblio). Asimov graduated high school early, starting college and writing his first published novel which he completed by the end of college (http://psu. edu). Asimov was a man who spent his entire life writing. His earliest writings were found in magazines. His friend and publisher John W. Campbell saw his early stories as rough but promising (http://psu. edu). The story that really launched his career was Nightfall. Nightfall was a simple story, written about how a society could potentially collapse if great change occurs even if that change is not inherently negative. In Nightfall and Other Stories, he writes, â€Å"The writing of ‘Nightfall' was a watershed in my professional career †¦ I was suddenly taken seriously and the world of science fiction became aware that I existed. As the years passed, in fact, it became evident that I had written a ‘classic'† (Nightfall and Other Stories). His career and fame continued to grow as the years passed. Beginning in 1942 and ending in 1945 he worked for the Philadelphia Naval Air Experimental Station (Biblio). During this time he started work on five novelettes and four novellas that are now known as the Foundation Trilogy. Of the trilogy, Charles Elkins of DePauw University wrote, â€Å"Among SF series, surely none has enjoyed such spectacular popularity as Isaac Asimov’s Foundation stories† (http://psu. edu). The Foundation series received numerous awards for its quality and content, eventually ending up in a Hugo award for Asimov (WorldsWithoutEnd). In the Foundation series, through the use of science fiction he tackled the issues he was passionate about. In his novel Pebble in the Sky he writes about racism. The story is written in the view of humans of other worlds holding a prejudice against Earth-dwellers because they â€Å"simply do not like the Earth† (http://psu. edu). He also tackled another issue that lays claim to how he lived his life. In book three of the foundation series, The Mayors, he begins to describe a religion that focuses on science (Foundation). As an atheistic humanist minority in a culture that was vastly overpoweringly theist, the best approach he took to tackling the issue of religion was through science fiction. As an educator at heart, he just wanted us to challenge the status quo with what we understand. In The Mayors, the religion of science worships a mythical galactic spirit. It is strikingly similar in some respects to modern religion, as this storybook religion had both a prophet, a story of how it all began, and a book of rules to live by (Foundation). His views on religion can be read inside the stories that he wrote. The life of Asimov cannot simply be summed up in a short phrase or story. He was an influential writer, attacking literature in many different writing formats. He fought for the rights of others, shaping our belief systems through the use of storytelling. He pushed for greater desire to learn in all of us, by writing of a robot that learned to become human (The Bicentennial Man 22). The call to be human and to remind us to be human was the goal of Asimov.